Legkeresettebb tartalmak:

GTA V csalások | Tőzsde | GTAO: Bikers (MC) | GTAO Szintek | RDR | GTAPlaceTV



GTA V - Gameplay elemzés

Módosítva: 2013. 07. 25. 14:36  |  Szerző: Shotgun

Mióta két napja megjelent a Rockstar Games sikersorozatának legújabb tagjáról készült hivatalos játékmeneti videó, a rajongóbázis egyszerűen feltüzelve várja az újabb és újabb információkat, pletykákat a játékról. Az elkövetkező időszakban érkező híreink ugyan nagy bizonyossággal szolgálnak majd sok érdekességgel látogatóink számára, jó szokásunkhoz hűen mégis úgy döntöttük, elkészítjük nektek az igen tartalmasra sikeredett videó részletes elemzését.

Az anyag 4 perc, 51 másodpercre rúg, és a játékmechanizmus alapvető változtatásait, néhány teljesen új lehetőséget, valamint a játékterület változatosságát mutatja be,egy női narrátor segítségével. Mondanom sem kell, hogy ez eddig az első olyan lehetőség, hogy ilyen hosszú ideig lássuk a Grand Theft Auto V-öt mozgás közben, és meg kell hagyni, hogy néhány aggasztó dologtól eltekintve, a fejlesztők már el is könyvelhetik a játék rendíthetetlen sikerét.

De elég is a karakterszám felesleges növeléséből. Jó szórakozást elemzésünkhöz!

Megjegyzés: A trailer általunk magyarul feliratozott változatát itt találjátok.

 

Első jelenet

Időtartam: 00:06 – 00:08

 GTA

Már az első bevillanó jelenetben találhatunk számtalan igen nehezen észrevehető részletet. A Los Santos városát napnyugta/napkelte során bemutató képkockák nem csak nagyon szépek, hanem többet rejtenek, mint azt gondolnánk.

A kép sokatok számára azt az érzést keltheti, hogy ez a jelenet nem új, valahol már láttuk. Erre indoklásként fel is hozható a legelső hivatalos trailer első jelenete, ami egy az egyben ugyanezen a helyen készült a városról, csupán más időpontban. Ám mégis van némi eltérés a két kép között.

 GTA GTA

A távolban meghúzódó felhőkarcolók között nem csak az ott cikázó léghajó jelenthet érdekes látványt, hanem a jobb szélső, még épülő darab, ami az első trailer megjelenése óta mintha közelebb állna végleges formájához. Egyébként ez nagy valószínűséggel a Mile High Club nevet viselő épület, amiről már kaptunk közelebbi képet is. Megfigyelhető a látótáv drasztikus növekedése is, amit okozhat a fejlesztési stádium változása, vagy a légszennyezettség mértéke, esetleg időjárási tényezők.

 GTA

 

Második jelenet

Időtartam: 00:08 – 00:10

 GTA GTA

A második jelenet valószínűleg Trevor és Michael US Bank Towerről való felszállását rögzíti. A képen nincs sok látnivaló, csupán a szokásos „H” jelzéstől eltérő 17-es szám a helikopterleszállón, ami akár a megjelenési napra utalhat. A jobb alsó sarokban lévő épületen esetleg még feltűnő lehet a PlayStation kontrollerekre hajazó háromszög, de nem hisszük, hogy nagyobb jelentőséggel bírna. A látótáv ismét megmutatja magát, az épület tetejéről tisztán láthatók a közelben cirkáló járművek, melyek között a GTA IV-gyel ellentétben, már buszok is vannak.

Ismerős lehet a jeleneten látható épület, hiszen ezen a hivatalos képen a három főszereplő pont az említett helikopterleszállón áll.

GTA  GTA 

 

Harmadik jelenet

Időtartam: 00:10 - 00:12

 GTA

Ezen a pár másodpercre sikeredett jeleneten sem nagyon láthatunk semmi különlegességet. Először kerül bemutatásra a búvárkodás mozgás közben, a víz alatti világ kidolgozottságát pedig a játékos előtti törmelékek spékelik meg. Feltehetőleg egy igen nagy hajótest oldalára fordult, elsüllyedt változatáról van szó. A hajón a "Safety First", azaz "Fő a biztonság" felirat olvasható... nos, ez nem igazán tükrözi a valóságot.

GTA

 

Negyedik jelenet

Időtartam: 00:12 - 00:14

 GTA

A következő kép Sandy Shores területét mutatja be, ahol ismételten nincs sok látványosság. Jobbra az Alamo Sea látható.

 

Ötödik jelenet

Időtartam: 00:14 - 00:18

 GTA  GTA  GTA

Itt kezd még érdekesebbé válni a videó, ugyanis közelről láthatunk egy sugárhajtású repülőt, mely a San Andreasban megismert Shamal-ra hasonlít.

Ahogy a jelenet továbbhalad, lehetőségünk nyílik első alkalommal látni az újradolgozott radart, mely a légi közlekedéshez beállított módon jelenik meg, így látható rajta a magasságmérő, valamint a már-már háromdimenziós nézet.

A grafikai elemek fejlesztése a napsütéstől kezdve a vízfelületen látható tükröződésig a lehető legészrevehetőbb.

Kivehető az is, hogy a repülőgép, mellyel a játékos áthalad a „Land Act Dam” nevű gát fölött, Los Santos városát keleti irányból közelíti meg, és ahogy a városhoz közeledik, kiírásra kerül a duzzasztógátat közrefogó hegységrendszer neve, azaz a „Tatavian Mountains” felirat.

GTA  GTA  GTA

 

Hatodik jelenet

Időtartam: 00:19 - 00:22

GTA  GTA  GTA

Trevort láthatjuk egy motorcsónakban, amint éppen egy nagyobb, vízzel fedett területen hajókázik. Nem sok érdekesség fogad minket itt sem, de érdemes elmerülni a részletekben, hiszen a vízeffektek, a tükröződés gyönyörű, a jobb felső sarokban pedig kivehető a repülők által égen hagyott kondenzcsík is.

A híd talán vonatok átkelésére is szolgál, a radar pedig ismét a járművekben való haladáshoz szokottra vált.

GTA

 

Hetedik jelenet

Időtartam: 00:22 - 00:24

GTA

Los Santos nyüzsgő éjszakai utcaszintű látképe terül elénk, ahol a Rockstar Games által való életben is hirdetésre használt hotel, az FBI-t parodizáló FIB épülete, valamint a CIA játékbeli másának, az IAA-nek főhadiszállása tekinthető meg.

A jobb oldalon szemünk elé tárul három karikatúra, melyek egy nagyobb reklám részei, ami valószínűleg egy „Fame or Shame” című valóságshow-t reklámoz. Ezek fölött pedig a „Hookah” felirat szerepel, ami vagy a vízipipákra utal, vagy az angol „hooker” szó egyfajta szlengesítése.

Bal oldalt talán a Mile High Club építkezésének egy részlete van, míg a háttérben a Vinewood felirat húzódik meg.

GTA

 

Nyolcadik jelenet

Időtartam: 00:24 - 00:26

GTA

A következő rövidke képsorokban egy hölgyet láthatunk rózsaszín felszerelésben átfutni a Los Santos városában található csatornák egyike fölött. A táj szép, a földrajzi megoszlás itt is látható, de érdekességnek talán csak a nő felkarján lévő telefontartó, vagy mp3 titulálható.

GTA

 

Kilencedik jelenet

Időtartam: 00:26 - 00:28

GTA

Feltehetőleg a San Andreasban szereplő Mount Chiliad V-beli mását láthatjuk itt felülnézetből. A hegy tetején és oldalán kisebb kijárt utak kanyarognak, a hegytetőn pedig egy kis kunyhó kapott helyett.

A hegy lábánál pedig egy Sandy Shores-ra hajazó kisebb város áll.

GTA

 

Tizedik jelenet

Időtartam: 00:28 - 00:30

GTA

Itt Michaelt láthatjuk, aki épp a Portola Drive-on található – ez valószínű, hogy a valós Rodeo Drive játékbeli mása - Ponsonbys öltönyház felé tartva mutatja be, hogy milyen járási animációkkal rendelkezik. Érdemes megfigyelni a járókelők kinézetbeli változatosságát, életszerűségét, ugyanakkor érdekes, hogy jobbra egy nagyon hasonló (talán ugyanolyan?) sötét rövidhajú, sötét zakós, fehér szoknyás, fekete cipős NPC lép be a képbe, mint amilyen balra távolabb sétál, de ez valószínűleg csak egy játékhiba.

A HUD ismét megjelenik, ám a radar a megszokott felülnézetes megjelenésre áll, ami a gyalogos közlekedésre jellemző. A rajta látható ikonok alapján ismét lesznek olyan küldetést adó karakterek, akiket nem fogunk egyből megismerni.

A kidolgozottság lenyűgöző. Még a pálmafa kérgén is meglátszik a részletes munka.

GTA

 

Tizenegyedik jelenet

Időtartam: 00:31 - 00:35

GTA GTA GTA

Először egy kisebb telepnyi hajléktalant láthatunk az egyik felüljáró lábánál. Ez ismerős lehet már az első hivatalos trailer ezen képkockájáról.

A következő vágásnál először láthatunk szarvasokat. Az egyik éppen a vízből iszik, ami feltehetően megint az Alamo Sea. Az időpont valamikor a reggeli/esti órákra tehető.

Majd hirtelen vágás Los Santos tengerpartjára, ahol a strandoló embereken kívül nem nagyon láthatunk mást, csak a gyönyörű hullámzási effekteket és a Jetski-t, amit ketten is megülhetünk akár.

 

Tizenkettedik jelenet

Időtartam: 00:36 – 00:38

GTA GTA

Pár képkockán belül mutatják be a hegyvidékek közelében található erdőket, földutakat, melyeken a Quad-okkal való közlekedés élvezetesnek tűnik.

Láthatunk pár szarvast menekülni, míg mellettük mintha két vadász, vagy túrázó haladna a víz felé.

A következő vágás pedig megmutatja a hegységek közti méreteket, plusz látható pár igen gyönyörűen kivitelezett viharfelhő az égen. Ez innen lehet ismerős már.

GTA

 

Tizenharmadik jelenet

Időtartam: 00:38 – 00:41

GTA GTA

Két szuperhősnek öltözött figura „rögtönzött” harca következik Los Santos kínai mozija mellett. Az egyikük a Halo Master Chief-jének paródiája, Republican Space Ranger – őt a Grand Theft Auto IV-ben ismerhettük meg -, míg a másik Impotent Rage, a GTA V újdonsült szuperhőse. A jelenetet egy NPC filmezi telefonjával.

Ezután kicsit komolyabb kép fogad minket, Los Santos belvárosával, pár üzletemberrel. A tér közepén az amerikai jelképpé vált sas egyfajta uralkodói pozícióban van a földgömbhöz képest. Hogy ez mire akar utalni, azt mindenki saját maga döntse el.

GTA

 

Tizennegyedik jelenet

Időtartam: 00:41 – 00:47

GTA GTA

Megjelenik az eddig még nem látott örmény autókereskedő, Simeon Yetarian, aki éppen Franklinnek magyaráz. Az asztalon egy Daily Globe újság van, a hely neve pedig PDM, azaz Premium Deluxe Motorsport. Franklin mögött egy „hónap dolgozója” plakát van, ami alapján úgy tűnik, hogy Yetarian kifejezetten egocentrikus személy lehet. A háttérben látható egy Bullet GT.

GTA GTA

 

Tizenötödik jelenet

Időtartam: 00:52 – 01:10

GTA GTA GTAGTAGTAGTAGTA

Ismét pár olyan rész, ahol nem igazán látunk sem újdonságokat, sem érdekességeket. Az első képsorozatban Michael, Franklin, Trevor és egy ismeretlen, kissé szerencsétlen kinézetű fickó találkozik egy apartmanban, ahol következő nagy dobásukon dolgoznak. A terv fel van firkálva a tapétára, és mintha egy kikötő területét ábrázolná.

Egy vágás után a Blitz Play című küldetés utáni pillanatok mozgóképként rögzített változatát láthatjuk, a felhasznált teherkocsival és egy éppen felrobbanó rendőrautóval. Miután minden elcsendesedett, tanácskoznak, hogy mi legyen a következő lépés.

A hátralévő részek Michael zűrös családi életébe engednek betekintést nyerni. A konyhában összeveszik fiával, amiért az igen csípős szavakkal illette, Amanda pedig próbálja leállítani őket. Érdekes lehet az Amanda mellett álló férfi, aki lehet csupán személyi edzője, de akár a szeretője is.

GTA

 

 

Tizenhatodik jelenet

Időtartam: 01:10 – 01:19

GTA GTA GTA

Most következik Franklin, aki először valahol a gettó területén sétál, őt követi kutyája, Chop. Ez megerősítést adhat arra, hogy a játékos küldetéseken kívül bármikor maga mellé csaphatja kutyáját társként. Látható pár bandatag is, az egyikük BMX-en ül, valamint a hangulat megteremtéséért egy szétszerelt motorbicikli váza díszeleg az utcán.

A ház falán, mely előtt főhősünk elhalad, a „SA Welcome back 88” feliratú graffity fogadja a játékost. Ez köszöntés lehet a Grove Street Families tagok részéről, mivel a banda '88-ban élte fénykorát. Alatta a „we missed you last time” felirat sokak szerint ismét köszöntést takar, de ez lényegében annyit jelent, hogy „legutoljára nem találtunk el”.

A radar ismét alaphelyzetben, az ikonok között pedig F betű jelenik meg az egyik ingatlanunkon. Ez azt jelentheti, hogy saját magunknak is dolgozunk majd néha a játék során. Az F betűn kívül ismét egy ismeretlen küldetésadó kérdőjeles jelzése látható.

Ami még feltűnő, az a „Se Renta” feliratú ház a háttérben, ahogy Franklin elhalad. Erről a Franklint bemutató trailerben is volt már anyagunk, melyen látható, hogy kidolgozott belső térrel rendelkezik.

GTA

 

Tizenhetedik jelenet

Időtartam: 01:20 – 01:27

GTA GTA

 Trevor következik, aki éppen egy lábat próbál leerőszakolni a WC lefolyóján keresztül. Hogy ez emberi láb-e, vagy valamiféle guminő lába, esetleg egy műláb, nem tudni. A fürdőszoba elég kidolgozott, bár rendetlen. A tartályon pornóújságok, a földön üveg hever.

 

Tizennyolcadik jelenet

Időtartam: 01:28 – 02:02

GTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTA

Innentől egy konkrét küldetés fő jeleneteit láthatjuk, ahol Franklin, Michael és Trevor az FIB épületéből rabol el egy személyt. Michael, miután Trevor az épület fölé navigálta a helikoptert – ami lehet, hogy egy Maverick -, leereszkedik kötélen a felhőkarcoló egyik ablakához – a folyamat közben a játék utasításokat és irányításbeli ismertetést ad, melyből kiderül, hogy ez a PlayStation 3-mas verzió -, majd azt betörve beugrik a tárgyalóterembe, ahol tűzpárbajba keveredik.

Ekkor látjuk először élesben a karakterválasztó kört, amely szürkén villogva jelzi a szükséges váltás időpontját. Ugrás a felhőkarcolótól jelentős távolságra lévő Franklinre, aki mesterlövészpuskával intézi el a Michael életére törőket. Érdemes megfigyelni a célkereszt változásait. A karakterválasztó kerék alsó felén látható a multiplayer karakter fölött van a „83 days” felirat, ami elég erős meggyőződésünk, hogy a legutolsó multiplayer játékunk óta eltelt napokat jelöli.

Visszaváltunk Michael-re, aki végez a maradék ellenfelével – közben fejlődik „shooting” képessége, amit a játék a radar fölött jelez, plusz feltöltődik speciális képessége -, majd menekülés közben ki kell lője az őket üldöző erősítést. Ennél a jelenetnél a jobb alsó sarokban egy stadionszerű építmény látható.

Végül pedig hirdetőtáblák: A jobb alsó sarokban CaCa, azaz egy Lady GaGa utalás, míg fölötte ismét reklám a „Fame or Shame”-nek. Az utolsó képen a „Chateau Marmont” játékbeli mása került jelölésre.

GTAGTAGTAGTAGTAGTA

 

Tizenkilencedik jelenet

Időtartam: 02:02-02:39

GTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTA

Megint egy hosszabb részlete a videónak, amin a karakterváltás mechanizmusát láthatjuk teljes pompájában. Először Franklin vásárol magának – egy már más szögből látott pályarészen – valamit, egy orvosi marijuana-t árusító bolthelységben – remélhetőleg ez játékelem -, melynek neve „Smoke on the water”, majd elhaladva az napszemüvegek standja mellett, átugrunk Michael-re, aki éppen egy bicajtúráról ért haza fiával, Jimmyvel.

Érdekes észrevétel lehet a karakterválasztás közben, hogy a térképtől való távolodásnál rálátást nyerhetünk a Los Santos-i golfpályára.

Az utolsó jómadárra, Trevorra való átváltás folyamatában ismét egy érdekes területre figyelhetünk fel a felülnézetből szemlélhető térképen, mely lehetséges, hogy a sokat emlegetett katonai bázist takarja. Felül pedig mintha a börtön egy kisebb szeletét látnánk.

Trevor éppen a rendőrök elől menekül. A börtön meglétét alátámasztva, a következő képkockákon mintha őrtornyok lennének a távolban, pontosan abban az irányban, amerre főszereplőnk halad.

Körözési szintje is okot enged adni némi találgatásra, ugyanis ötös, maximum körözésnél két rendőrségi helikopter, jó pár darab járőrautó és egy-kettő rendőr SUV is üldözi. A kameraállás, ahol a játékost az őt üldöző rendőrautó motorháztetejéről nézhetjük, ismét visszatért. A vezetést illetően annyi megjegyeznivaló lehet, hogy az autók kanyarodása már kicsit az arcade felé sodorja az élményt, aminek mértékéről nem tudni, de az előzetesek egyikében a Rockstar utalt a vezetési mechanizmus ilyen irányba történő változtatására, hogy az autók irányítása közben ne érezzük úgy, hogy egy szárazföldi hajóval van dolgunk. Az off-road jelenet fizikai elemei ettől függetlenül még mindig lenyűgözőek.

A lényeges itt talán az, hogy megtudjuk, milyen is belepillantani karaktereink véletlenszerűen végrehajtott hétköznapi tevékenységeibe.

GTAGTAGTA

 

Huszadik jelenet

Időtartam: 02:40 – 02:46

GTA GTAGTAGTAGTAGTAGTAGTA

Pár, az autók, illetve karaktereink testreszabhatóságával kapcsolatos kép jön, ahol láthatjuk az eddig csak írásban megismert Los Santos Customs működési elvét, így a járművek tuningolásának folyamatát, valamint karaktereink ruházatának változtatását.

Visszatér a SubUrban üzletlánc, amit anno a San Andreasban ismertettek meg velünk a fejlesztők.

Járműtuning közben látható, hogy ezúttal nem csak a tuningelemek, hanem autóink tulajdonságai is kijelzésre kerülnek, mely a teljesítményt fokozó eszközök felszerelésénél számíthat nagyon hasznosnak.

Azonban érdekes, hogy a programozók ezúttal egy igencsak praktikátlan döntés folytán kivették a színpalettát, ezáltal most csak egy teljesen egyszerű, név szerinti listából válogathatunk a színek között. A lista jobb felső sarkában lévő számok alapján ehhez az autóhoz – feltételezhető, hogy autónként más színválaszték áll rendelkezésünkre – összesen 75 különféle szín választható, de ez csak az autó külső megjelenésére vonatkozik, a belső színek – amiket ugyancsak a San Andreasban még megváltoztathattunk – itt nem kerültek variálásra.

A színek kiválasztása mellett a kerekek közötti keresgélés is bekerült a videó ezen képsorozatába. Látható, hogy olyan tételek is vannak a menüben, melyeket még nem érhetünk el. Ezeket a játék egy kis lakat ikonnal jelöli. Összesen 26 különféle stílusú kerék érhető el, de mint már említettem, ez lehet, hogy autónként több, vagy kevesebb.

A képernyő jobb alsó sarkában lévő magyarázat szerint autónkat több szögből is megnézhetjük.

A szerelt autó egy Sentinel, amely a garázsból való kiálláskor már nem az előzőleg látott rendszámtáblával rendelkezik – a bal felső sarokban egyébként már a „jun” rövidítés szerepel, ami június hónapra utal –, ami nem csak a feliratra vonatozik, hanem annak színére is. Ez utalás lehet a rendszámtáblák testreszabhatóságára is.

Emellett még a Rockstar szokásos humorára utalhat az „STD” felirat, mely a Sentinel Tuning Division logója, – jelentése Sentinel Tuning Részleg -, de egyben az angol „Sexually Transmitted Disease” kifejezésre utalhat, ami a szexuális úton terjedő betegségek gyűjtőneve.

A háttérben egy dolgozó húzódik meg a garázsban, ami megint egy olyan újdonsága a játéknak, mely életszerűbbé teszi.

A SubUrban üzletére visszatérve, 12 farmer és 12 dzseki érhető el, ezek közül pedig ismét van olyan, melyeket csak később oldhatunk fel a játékban. A ruhák árai, feltehetően a gazdasági helyzetből adódóan igencsak borsosak. Egyébként érdekes, hogy mennyire jó lehetőséget ad ez a játék számára a pénz értékének megbecsülésére. Tehát a GTA III-ban és IV-ben tapasztalt "túl sok pénz" élménye itt nem igazán lesz jelen.

 

A tuningról egy későbbi cikkünkben olvashattok részletes elemzést.

GTAGTAGTA

 

Huszonegyedik jelenet

Időtartam: 02:46 - 03:08

GTA GTAGTAGTAGTAGTAGTAGTAGTAGTAGTA

Áttérünk a sportokra, új tevékenységekre, melyek közül betekintést nyerünk egy röpke pillanatra a golf, a jóga, a búvárkodás, vadászat, és fejvadászat világába.

A golfnál látható részletesség ismét elismerésre méltó a fejlesztők részéről, hiszen már-már külön, ehhez a témához kapcsolódó játékokat megszégyenítő részletességgel gondoskodtak az adatok, illetve a pályatérkép kidolgozásáról.

A bal felső sarokban látható az éppen ütést végrehajtó játékos neve, alatta pedig a bal alsó sarokban egy átfogó térkép a pályarészről, a lyuk számával, a par számával, illetve hogy hány yardra vagyunk a lyuktól. A játékos mellett jobbra egy mérce szerint lőhetjük be a lendítés erősségét, mellette pedig konkrét adatok szerepelnek az erősségről, a távolságról, a magasságról, mely adatok az elütés pillanatában változnak, folyamatosan jelzik a labda helyzetét. A jobb felső sarokban ismét pár érdekes, fontos adat olvasható, az ütő típusa, a szélirány és szélerősség, illetve a labda jelenlegi helyzete.

A jóga nem igazán kecsegtet sok izgalommal, de egy régebbi előzetesben szóba került, hogy akár saját órákat is indíthatunk. Ez persze nem biztos, de érdekes húzás lenne a játékban.

Látható, hogy búvárkodásnál még a merülés előtti pillanatok is részletesen animáltak. A háttérben valamilyen ipari jellegű épület van.

Vadászatnál Trevor felszerelése egy terepmintás ruhát takar, a lakókocsija mögött egy quad áll, a szarvas becélzásakor pedig a vadászpuska célkeresztje mellett jobbra a szélerősség és szélirány adatai találhatók.

Franklin elsétál egy látszólag vérbeli patrióta előtt, aki kezében a "This is the land of opportunity. GET OUT!", magyarul "Ez a lehetőségek hazája. TŰNJ INNEN!" feliratú táblával hadonászik. A térkép általi jelölést figyelve ez lehet az egyik a Red Dead Redemption, illetve a GTA IV történetét is színessé tévő véletlenszerűen megjelenő küldetésadóknak. Nyomban miután áthalad karakterünk a furcsa kinézetű figura előtt, egy autó halad el a kamera előtt, motorcsónakot vontatva. Ez ismételten egy olyan fícsőr, ami remélhetőleg a játékosok által is kiaknázható.

Végül megint a rosszéletű Trevor jelentkezik, aki éppen egy férfit lök be egy igazi vidéki surmóhoz illő kis házba, melynek tornácán egy túlsúlyos, enyhén ápolatlan hölgy internetezik, valószínűleg a Trevor által éppen leszállított úriember képével a képernyőn. A laptop természetesen az Apple paródiájának, a Fruit cég terméke.

GTAGTAGTAGTAGTAGTAGTAGTAGTA

 

Huszonkettedik jelenet

Időtartam: 03:08 - 03:21

GTA GTAGTAGTAGTAGTAGTA

Ha egyesek szerint eddig a játékmeneti anyag unalmas részeiről beszéltünk, akkor talán Franklin akciódús fegyverpárbaja a fűrésztelep helyi rosszfiúival megmentheti a rajongókat az unalomtól.

Itt szembesülhetünk azzal, hogy a fedezékek mögötti mozgás, a fegyverek váltása, a célzórendszer, a roham közbeni lövés és még sok más szempontja a játéknak, mennyit dob majd az ilyen küldetések non-linearitásán.

Az autók szélvédői sokkal realisztikusabban törnek be, maguk mögött hátra hagyva egy kisebb törmelékkeretet.

Viszont akad némi olyan változtatás, ami lehet, hogy nem tetszik a rajongóknak. Az egyik ilyen, a fegyverikonok jobb felső sarokból való eltűnése. Ezt persze indokolja az újonnan implementált, szinte egy az egyben a Red Dead Redemptionből átültetett fegyverválasztó kör, de mégis kényelmetlenebbé teheti a játékos életét, ha még nem szokott hozzá ehhez a mechanizmushoz. Fegyverválasztás közben a videón is észrevehető, hogy az idő a mi javunkra lelassul, ami ellensúlyozza a kissé kellemetlen helyen lévő kerék pozícióját. Külön részen mutatja a játék a kiegészítőket, mint például az ejtőernyő meglétét.

Választás közben a jobb felső sarokban egy kisebb menü mutatja, hogy egy-egy fegyver milyen tulajdonsággal bír: sebzés, tűzsebesség, pontosság és lőtáv.

Egyelőre azt senki sem tudja, hogy ez biztosan így van-e, de főszereplőnk lövései során a radaron egy kisebb vörös kör jelenik meg, mely a lopakodás szempontjából fontos hangzavar mércéjét jelentheti. Ergo ha elsül egy hangtompító nélküli fegyver, akkor a kör sugara határozza meg, ellenfeleink milyen távolságra hallhatják meg jelenlétünket. Aki kicsit ügyesebb megfigyelő, az észrevehette ezt a kört akkor is, mikor az előttünk lévő autó felrobbant.

Az animációk folyamatosak, töretlenek és láthatóan sokat fejlődtek a GTA IV, néhol darabos mozzanataihoz képest. Franklin egy igazi hidegvérű gyilkos módjára manőverezik a golyózáporban. A részletességre az utolsó képen látható lőfegyver újratöltése teszi a pontot. 

Franklin fülében egy headset van.

GTAGTAGTA

 

Huszonharmadik jelenet

Időtartam: 03:21 – 03:24

GTA GTAGTAGTA

Ismét egy utcaszintű kép, ahol egy 9F száguld végig az úton. Számtalan színes neonfénnyel ellátott bolt tűnik fel, például a MissT, feliratú helység, ami sokak szerint újabb ruházati szaküzlet, de a dizájnt, kialakítást tekintve „egyéb” szolgáltatást nyújtó boltnak tűnik.

Következik egy „Blazing Tatto” névre hallgató tetoválószalon, mellette a Doppler mozival, amit ezen a hivatalos képen láthatunk Michael mögött közelebbről. Kicsit távolabb balra egy „Clappers” nevű étterem ígér steak-et és sajtot, csütörtökön pedig „egyél amennyi beléd fér” alkalmakat. Jobbra egy „Tsunami” nevű hely látható.

A Rockstar által játék elé ültetett játékos nagyon tehetséges lehet, ugyanis az autóval való manőverezés igen szép. A vezetés egyszerűségére ugyan egyértelmű választ nem találunk, de nagyon valószínű, hogy a volán mögött az igen jó autóversenyző hírében álló Franklin ül. A fizikai megvalósítás ugyancsak ködös, hisz az út, a rajta megtörő fényeket szem előtt tartva elég nedves.  

GTAGTA

 

Huszonnegyedik jelenet

Időtartam: 03:25 – 03:38

GTA GTAGTAGTA

Még több időtöltésről rántódik le a lepel. Trevor szemszögéből megmutatkozik a lőtér, mely kompetitív és nagy valószínűséggel fejleszti képességeinket a fegyverek terén. Ez az AmmuNation Gun Club belsőtere.

A képernyő bal felső sarkában a játék elárulja, hogy minden egymás után következő találatért bónuszpontot kapunk, de ez a bónusz nullázódik, ha egy lövés is mellé megy. A táblák sorra jelennek meg a pályán és ahogy látható a bal alsó sarokban, az olyan adatok is szem előtt vannak, mint jelenlegi szorzónk, a már lement, illetve hátralévő célpontok száma, pontszámaink által adott szintünk – mely lehet bronz, ezüst és arany –, pontszámunk, és a hátralévő idő. A lövészeti tevékenység valószínűleg az idő lejártával, vagy töltényeink elfogytával fejeződik be, azonban önszántunkból is elhagyhatjuk a küldetést.

A következő mini-játék a tenisz, mely ismételten nagy kidolgozottsággal rendelkezik. A bal felső sarokban a két játékos neve szerepel, a jelenlegi forduló számával és a pontszámokkal. Kisebb Easter Egg talán az, hogy a két játékos neve itt Michael, és Jordan. Az ütés erősségét a függőlegesen megjelenő sávot figyelve kontrollálhatjuk, míg a jobb alsó sarokban az irányítási információkat olvashatjuk.

Bicikliverseny képe tárul elénk, ahol az animációk ismét meglepően jól sikerültek, az odaillő felszerelésekkel együtt. A jobb alsó sarokban lévő doboz informál minket az erőnlétünkről, pozíciónkról a verseny során, valamint eddig futott időnkről. A radaron sárga pontok jelölik az ellenőrzőpontokat.

Következzék az ejtőernyőzés, mely csupán talán a szél befolyásának tekintetében változott sokat. Ahogy a talaj felé érkezik karakterünk, szembetűnővé válik egy ház a távolban, aminek kissé mintha hiányosak lennének a textúrái, vagy esetleg a szürke rész egy letakart medence lehet még. A radar ismét profilt vált, láthatóvá válik a magasságmérő. A hely valahol ezen a környéken van, és akár egy lehetséges rablás folyamatának első lépése lehet.

GTAGTAGTA

 

Huszonötödik jelenet

Időtartam: 03:38 – 04:20

GTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTA

Áttérünk a komolyabb üzletre, azaz a rablásokra, valamint azok kivitelezésére. Az első pár jelenet a Blitz Play küldetés -- részletezve a küldetések cikkünkben -- kivitelezésével kapcsolatos tanácskozást mutatja a három főszereplő között. A Trevor háta mögött lévő törékeny tartalommal bíró doboz oldalán augusztus 17. dátuma szerepel, ami jelentheti a következő gameplay megjelenési dátumát, vagy csupán egyfajta semmilyen jelentőséggel sem bíró apró részletet a játékban.

Jelenetek egyenesen a pénzszállítókocsi kirámolásáról, ahol megmutatják a szemeteskocsit, amivel eltorlaszolja Michael az utat a páncélozott jármű előtt, a vontatókocsit, amiben Franklin ül és felborítja a pénzszállítót, valamint egyéb apróságokat, mint az alacsony betonfal apró szilánkokra törését. A járművek törésmodellje szinte biztosan kikapcsolásra került a játékmeneti videó készítése apropóján. Mintha valamit rejtegetne a fejlesztőcsapat.

Ennél a jelenetnél ismét egy body shop van a háttérben, mely kipufogókat és abroncsokat ígér. Az egész terület egyfajta ipari negyedre hasonlít.

A következő jelenetben ismét ismeretlen karaktert láthatunk, aki valamiféle mesterelme szerepét töltheti be a tervek kivitelezésében. Ő az, aki felvázolja az ékszerboltba való betörés módszereit, mely lehet okos, vagy inkább eszeveszett módon hangos.

A szoba falán egy rablás tervei vannak, amely az előző jelenetben bemutatott kisvárost ábrázoló térképen, illetve a köré kitűzdelt cetliken, képeken kerül részletezésre. A „To do”, azaz a teendők listája fentről lefelé haladva: a kisváros felderítése, védelmi rendszer tesztelése, rendőri reakció idejének megmérése, csapat kiválasztása, katonai felszerelés megszerzése. A bal felső sarokban lévő cetlin, alig kiolvashatóan a „Need military grade hardware”, magyarul „Katonai jellegű/szintű felszerelésre van szükség” szöveg biztosít minket arról, hogy valamilyen fejlett technológia eltulajdonítása lehet a cél. Jobb oldalt fent egy felülnézeti térkép, ismét a valószínűsíthetően Google Maps szolgáltatást lemásoló eyefind jóvoltából. A kisváros neve, a bal felső felirat alapján „Paleto” lehet.

A következő kisebb pénzszerzési meló az ékszerbolt kirámolása, amit már nagyon sokszor láthattunk trailerekben, vagy képeken. Itt jóval részletesebb terv van a parafatáblán, a „crew” cetli alatti csapat részletezésével – ahol egyébként Gustavo Mota eléggé hasonlít a felhőkarcolóba történő betörés során megszöktetett személyre –, akiknek képei és adatai az FIB adatbázisából szerzett lapokon vannak feltüntetve, az „approach”, azaz megközelítés módjával – ez lehet loud, azaz hangos, illetve smart, azaz okos –, és végül a teendők listájával.

Az elkövetkező képkockák egyértelműsítik a lehetőségeinket. Használhatunk az okos módszerhez híven a szellőzőrendszerbe juttatott altatógázt, vagy berohamozhatunk üvöltözve, fegyverekkel a kezünkben.

A Vangelico ékszerbolt rablása során a radaron látható pontok jelzik a mozdítható, értékes holmikat, a jobb alsó sarokban pedig a „take” dobozban látható pénzösszeg az összegyűjtött szajré értékét mutatja. Érdekes, hogy csupán egyetlen kis adag ékszer képes majdnem 100 000$-ral megnövelni a bevételeket.

A rablásokról ismételten egy későbbi cikkünkben olvashattok részletes leírást.

GTAGTAGTAGTA

 

Huszonhatodik jelenet

 Időtartam: 04:20 – 04:32

GTAGTAGTAGTAGTAGTAGTAGTA

A pénzszerzési módszerek után most a költekezésre kerül sor. A narrátor bemutatja a lehetséges „pénzkidobási” lehetőségeiket, melyek közé a Trevorra felvarrható tetoválások, az autók, illetve tuningolásuk, részvények, üzletek és lakások megvásárlása tartozik, sok más említetlen lehetőséggel.

A tetoválószalonban összesen 16 darab látható, de ez esetleg karaktertől függően, vagy magától a tetoválószalontól függően változó lehet. Ismét visszatekintve a San Andreas rendszerére, itt már nem testrészenként választjuk ki a tetkókat, hanem egy leegyszerűsített listából. Nem sok érdekesség látható... az üzlet helység kidolgozott.

Ismét egy autós üldözés, a játékos csak úgy cikázik a szembejövő autók sávjában. Nyomban a képsorozat kezdeténél jobbra szerepel egy hirdetőtábla, NONSTOP POP 100.7 FM felirattal.

Kis betekintés az interaktív, immáron szereppel is rendelkező weboldalak világába. Az első ilyen a BAWSAQ – a GTA IV-ben már szerepelt –, azaz a tőzsdei oldal – egyébként a BAWSAQ nem csak a NASDAQ paródiája, hanem kiejtésileg az angol „ballsack”, azaz „herezacskó” szót takarja –, ahol befektethetünk vállalkozásokba. A kurzort érdemes figyelni, ugyanis mikor egy klikkelhető hivatkozásra visszük, egyből egy középső ujját mutató kézre vált. Nem szép, Rockstar, nagyon nem szép.

A következő internetes oldal már az ingatlanokkal foglalkozó Dynasty 8, ahol megvásárolhatjuk az általunk kinézett házakat, villákat, igencsak borsos áron.

Az eddig ismert weboldalakról egy későbbi cikkben olvashattok részletesebben.

GTAGTA

 

Grand Theft Auto Online

GTAGTAGTAGTAGTA

És végül egy magáról eddig igen keveset hallató aspektusába tekinthetünk bele a játéknak, azaz a multiplayerbe, melyet a Rockstar sejtelmesen csak Grand Theft Auto Online néven emleget.

Ebben a jelenetben egy a többjátékos módra konfigurált karakter néz ki egy magasan a város utcaszintje fölött húzódó apartman ablakán, rálátva a Los Santos utcáin randalírozó fejlesztőkre. Sokat nem tudunk eddig erről a játékmódról, de különböző események is jelölésre kerültek a radaron, mint például autóversenyek és bázisugrások, emellett a játékosok jelölése fehér pöttyök által.

A fejlesztők közüli legnagyobb számmal rendelkező játékos a 19-es számozással bír, ami végül enged következtetni arra, hogy hányan játszhatunk online egyidejűleg. Ugyebár amíg nincs hivatalos infó a teljes multiplayerről, addig csak ennyit tudhatunk biztosan.

GTAGTA

A többjátékos mókáról GTA V szekciónkon belül olvashatsz.


Ennyi lenne tehát elemzésünk a GTA V hivatalos játékmeneti videójáról. Remélem, hogy mindenkinek tetszett a legkisebb részletekig hatoló leírás. Észrevételeiteket, javaslataitokat privát üzenet keretében, felém eszközöljétek.

Social
Kövess minket Facebookon, Twitteren és Tumblren, a főbb hírek mellett különböző érdekességeket is posztolunk!



Tumblr
GTA V
Ki van itt?
Jelenleg 8 vendég böngészi az oldalunkat.
Kiemelt partnereink
Társoldalak